circad | circRNAs associated with diseases

CircIBTK
Gene	IBTK	Organism	Human
Genome Locus		Build	hg19
Disease	Systemic Lupus Erythematosus	ICD-10	Drug-induced systemic lupus erythematosus (M32)
DBLink		PMID	29884225
Experimental Method
Sample Type	Tissue and cell lines	Comparison	42 patients and 35 age-matched and gender-matched healthy controls
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward CTTACATGTCTGCTGCTTTTGG Reverse GAGACACATAAGCAATTCACTGC	Statistics	Fold Change : Downregulated pvalue : <0.05
Citation
Wang, X, Zhang, C, Wu, Z, Chen, Y, Shi, W (2018). CircIBTK inhibits DNA demethylation and activation of AKT signaling pathway via miR-29b in peripheral blood mononuclear cells in systemic lupus erythematosus. Arthritis Res. Ther., 20, 1:118.